fms5she5atieShiranie
fms5she5atieShiranie fms5she5atieShiranie
  • 24-03-2016
  • Social Studies
contestada

What railroad tycoon was known for consolidating railroads?
a. Fisk
b. Grant
c. Vanderbilt
d. Carnegie

Respuesta :

josephthelearner
josephthelearner josephthelearner
  • 25-03-2016
Cornelius Vanderbilt. He was a great during and after the Industrial Revolution. He made a great amount of money with his railroads.
Andrew Carnegie- he was known for his steel works.
Though for whoever made this question it would have good to make one of the answer choices Rockefeller another great during those times. For he was known to work with Vanderbilt at one time. 
The other choices I have no voice on them.
Answer Link

Otras preguntas

I need somebody's help..
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?
write a sentence with the word labyrinth
Lexington County Army Air Base in Columbia South Carolina bears the distinction of being one of the training sites for A) the Tuskegee Airmen. B) Doolittle
choose the correct helping verb the tadpoles have or had moved into the pond
PLEASE HELP ME ASAP 10 POINTS
what does hafa adai mean in guamanian
When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated
10(x+3)=9 mmmmmmmmmmmmmmmmm