michael515058 michael515058
  • 25-10-2018
  • Biology
contestada

DNA tacaggtacccgaacccaattta

Respuesta :

sarahandlill3
sarahandlill3 sarahandlill3
  • 25-10-2018
Is that even a question?
Answer Link

Otras preguntas

1. manganese dioxide is used in dey cell . ( Give reason)2. Fuses are used in a circuit. ( Give reason )​
The ratio of passenger cars to cargo cars in the rail yard is 7:35. If there are 105 cargo cars, how many cars are there altogether?
The swimming pool shown below has a 6 foot wide concrete deck around it. What is the area, in square feet, of the deck around the pool? O512 O720 O864 O1232
Find the area plllllllllssssss
what is the volume of a 6 by 8 cone?
hello people ~Assertion: Acrylic fibres are used in making socks and shawls.Reason: Acrylic fibres are a replacement or woolen fibres.A. Both assertion and reas
Can the sides of a triangle have lengths 7.6, 2.5, and 2.2?
Use this dictionary entry to answer the question. post- (prefix): a prefix, meaning behind, after, later, subsequent to, posterior to What does the word postgra
if the width of a rectangle with periemter is P is 6 units what is its length write using algebra
Look closely at this painting by a Hudson River school artist. What theme does this painting represent?