lorriebartha lorriebartha

26-05-2019
Mathematics

contestada

Which word does NOT belong with the others? A. triangle B. circle C. oval D. sphere

Respuesta :

surn1930 surn1930

26-05-2019

Answer:

A triangle

Step-by-step explanation:

If you slice open all of these shapes you will see a circle except the triangle.

Answer Link

Аноним Аноним

26-05-2019

Answer:

A triangle because the other shapes are to do with circles.

Answer A.

Answer Link

Otras preguntas

Answer the question plz

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

Find the measure of angle y. Round your answer to the nearest hundredth. (please type the numerical answer only)

find the solution to the following system of equations using substitution or elimination

Read the situation provided below and provide a detailed response. Include examples and assumptions. Attached the picture of your output. If you will be given t

HELP ASAP!!!! Need to get grade up

Why is the moon abiotic?

State your claim. Make sure you are stating it as a fact what does it mean?

Can someone please help me as soon as possible thanks

Please help what is 80 less than x?