Lepcmileskatkin Lepcmileskatkin

24-07-2016
History

contestada

About how many people died in the civil war?
a. 10,000
b. 60,000
c. 100,000
d. 600,000

Respuesta :

jessicahight jessicahight

24-07-2016

the answer is D it was 620,000

Answer Link

Otras preguntas

Allergies are the most common type of immune system disorder. Describe an allergic reacion and explain why it may be harmful. (5 marks)

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist

Elaine bought a total of 15 shirts and pairs of pants. She bought 7 more shirts than pants. How many of each did she buy?

Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio

Question 16 of 20 Select the best answer for the question. 16. Which of these federal policing agencies is part of the U.S. Department of the Treasury?

Fill in the chart below. Please use the phrase ‘almost none’ for the lower two rows if it applies.

which process do scientists think provided earth with an oxygen- rich atmosphere

Kohlberg believed that human moral development is strongly based on the fact that we all have a desire for justice and a(n) __________. A. impartiality for fair

if you are given a 2% raise and inflation rate is 3% you are