abbigailmcmorrow1 abbigailmcmorrow1
  • 22-04-2020
  • History
contestada

what is the fundamental facilities and systems serving a country, city, or area, such as transportation and communication systems, power plants, and schools called

Respuesta :

mcleroyajdan mcleroyajdan
  • 23-04-2020

Answer:

An Infrastructure

Explanation:

Answer Link

Otras preguntas

Does old age means end of life according to A Tennyson in Ulysses
How can global warming lead to changes to the Earth’s surface? a. Global warming can lead to an increased number of earthquakes, which change the Earth’s surfac
1) A fashion designer makes and sells hats. The material for each hat costs $5.50. The hats sell for $12.50 each. The designer spends $1400 on advertising. How
Family values in Ancient Rome included obedience to elders and devotion to the gods
1+4 = 5. 2+5=12. 3+6=21 8+11==?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
the sale price of a bicycle is $120 this is 75% of the original price find the original price
plot and steps for writing a comedy please!!!
​What is the primary way that combination birth control pills work to prevent pregnancy?
what does beowulf offer hrothgar as a prize