danelly12 danelly12
  • 25-04-2020
  • Mathematics
contestada

Find the value of each variable please

Find the value of each variable please class=

Respuesta :

usererror1 usererror1
  • 25-04-2020

Answer:

error

Step-by-step explanation:

Answer Link
Hrishii
Hrishii Hrishii
  • 25-04-2020

Answer:

x = 37

Step-by-step explanation:

[tex]x \degree = \frac{1}{2} (100 \degree - 26 \degree) \\ \hspace{12 pt}= \frac{1}{2} \times 74 \degree \\ \hspace{12 pt}= 37 \degree \\ \huge \red { \boxed{x = 37}} \\ [/tex]

Answer Link

Otras preguntas

When is cash pulled out of circulation
why can't the position of an electron be determined with certainty?
Instructions:Select the correct answer .In this line from Thomas Paine's Rights of Man, what element denotes that it is from the Revolutionary era? There exist
Discussion the following: Compare and contrast 1. a. Niacin b. Folate c. B12 deficiency d. Riboflavin Thank you
Why it is not possible to draw a square that is not a parallelogram
what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
what does beowulf offer hrothgar as a prize
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what is the law of conservation of mass?
state one reason of magazines has negative impact on individual right in a democratic society