iliyahi iliyahi

22-09-2020
Mathematics

contestada

what is 315.41 rounded to the nearest whole number?

Respuesta :

CedarWolf CedarWolf

22-09-2020

To the nearest while number it is 316

Answer Link

harryjupiter148 harryjupiter148

22-09-2020

Answer:

315.41 rounded to the nearest whole number is 315. 4 is not up to 5, so it can't be turned into 1 to be added to 5. It stays as 315.

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

how can a driver best be prepare to enter sharp curves

Is sextillion a real number?

why are cancer causing factors in lifestyle and environment difficult to identify

Which of the following ideas best fits with biological evolution by natural selection? 1.The most fit individuals are those with the highest reproductive succes

Which best explains how the structure of the office of the president helps fulfill the office’s role? A The office is led by the chief of staff, who serves as a

Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.

What to numbers can be added up the six multiplied to nine

what was the key philosophy held by founding fathers

What type of triangle is this?