montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

What was the purpose of the Spanish colonies?

When washing the dishes, you most likely used an animal from the _____ phylum. Porifera Cnidaria Nematoda Mollusca

While state courts will address violations of state laws, they are not equipped to handle cases in which __________. These cases are in the domain of the federa

Which organelle is responsible for breaking down old organelles? A. digestive vacuole B. lysosome C. endoplasmic reticulum D. Golgi apparatus

What was primarily responsible for the formation of a delta glacial erosion incrementation of sediment deposition of sediment mass movement 3. Which event is

The most penetrating type of radiation is _____ radiation. a. positron b. beta c. alpha d. gamma

Explain three ways you can get home safely, without getting behind the wheel, if there are drugs or alcohol in your system.

Choose the appropriate pronoun. Steve made friends _____ later worked with him. which who

What is 51/2 × 21/3? A. 132/5 B. 131/6 C. 127/8 D. 125/6

Write the expression below in standard form. 27h÷3h