janaeh2011 janaeh2011
  • 24-10-2020
  • Chemistry
contestada


4. A certain object has a volume of 25.0 mL and a mass of 100 g. What is the density of the
object?
00.250 g/mL
04.00 g/ml
125 g/ml
2500 g/ml

Respuesta :

808mello
808mello 808mello
  • 24-10-2020

Answer:0.400 gl

Explanation:

Answer Link

Otras preguntas

specificity is important to fitness program because it
An air force plane flew to Jakarta and back. On the trip there it flew 480 km/h and on the return trip it went 288 km/h. How long did the trip there take if the
a water sample could be negative for enterococcus and coliforms and still be a major public health threat. why? Why can filitration be used to sterilize culture
which simple machines is NOT a wedge?
What makes for good scientific data
Which process must occur before collection? A:precipitation B:condensation C:evaporation D:none of the above
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Explain why 2.15 and -2.15 are are opposites?
A sales tax of 6% is added to the price of an item.If Marisa buys an item which expression indicates how much she will pay in all.A,n+0.06,B,0.06n,C,n+0.06n or
how to solve these questions?