olivia424 olivia424
  • 25-10-2016
  • English
contestada

If you needed to replace an overused word in an essay you are writing, which resource would give you the best choices?

Respuesta :

HBR2001 HBR2001
  • 25-10-2016
Probably a thesaurus.
Answer Link
legamezz
legamezz legamezz
  • 25-10-2016
A thesaurus right or a dictionary
Answer Link

Otras preguntas

the surface of water connect like a sort of sort of skin due to property of liquids called
what would you use chromatography for?
Why wood suitable to build boats and rafts
Which best describes the climax of the Odyssey? A. Odysseus kisses the ground as his journey home comes to an end. B. Odysseus sees Telemachus for the fir
If luisa travel 5 miles west then 8 miles south then 2.5 miles west how far is she from where she started?
Chloe’s mother wants to have another child. However, she is concerned that a second child might also have CF, so she encourages Chloe’s stepfather to be tested.
Guys <br /> I want the word resolute and naturalization in a sentence separate
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What is the source Code of transcription
What is the source Code of transcription