bdominic07 bdominic07

25-02-2021
Mathematics

contestada

4.2r - 12.68 = 10
how to sole it to plz

Respuesta :

25-02-2021

r=5.4

4.2r-12.68=10
+12.68 +12.68
4.2r=22.68
4.2/4.2 22.68/4.2
22.68/4.2= 5.4

Hope this helps! Have a great day :)

Answer Link

akaiqbacon akaiqbacon

25-02-2021

Hi there!

r=5.4

1.Add the terms:

[tex]22.68*4.2=5.4[/tex]

2.Divide the two terms:

[tex]22.68*4.2=5.4[/tex]

Therefore, r=5.4.

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What does the term human rights mean

elevated blood cell count can be a result of: A. bacterial infection B. viral infection C. parasitic infection D. immune hypersensitivity/ allergic reactions E.

The tube that connects the bladder and the outside is called the

what finger does the ring go on

John Locke would have agreed with all of the following statements EXCEPT:

Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?

Siri has half the amount of quarts in a gallon how many cups are in those quarts if there are 4 quarts in a gallon

what is 0+50×1-60×0+10=

how many atoms are present in 4.0 mol of sodium