andrewc998 andrewc998
  • 23-10-2021
  • Mathematics
contestada

Solve for x please
A)-8
B)-9
C)8
D9

Solve for x please A8 B9 C8 D9 class=

Respuesta :

serieuxtony
serieuxtony serieuxtony
  • 23-10-2021

Answer:

My answer is -9.becasiug

Answer Link

Otras preguntas

Do left-handed or right-handed people make more money? one study1 recorded the hourly earnings for a random sample of american men, of whom were right-handed an
I’m what way did British leaders misunderstand the revolutionary war
Identify the one illogical comparison among the following examples. Tim’s parrot learned to speak more quickly than did Mr. Riley’s. We wondered if parakeets
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
What is one purpose of fair use laws? A. to prevent anyone from using copyrighted material B. To give students the right to enhance their education while protec
Buying insurance and investing for the future requires spending less in the present. Why is this a hard choice for many people? Would it be hard for you?
Who defeated and then abolished the janissary corps?
Three ballet dancers are positioned on stage. Shereen is straight behind Haley and directly left of Eric. If Haley and Shereen are 4 feet apart, and Eric and Ha
Which equation in point-slope form contains the point (2, 3) and has slope 2? a. y + 2 = 2(x + 3) b. y – 3 = 2(x – 2) c. y – 2 = 2(x – 3) d. y + 3 = 2(x + 2)
How did Spain’s loss of economic power in the 1800s affect life for Filipinos?