wwwbrooklynelfp4w7t3 wwwbrooklynelfp4w7t3

22-10-2019
Biology

contestada

How do you solve x/100 = 54/87.5

Respuesta :

tumblrtrash tumblrtrash

22-10-2019

Answer:

~61.71

Explanation:

cross multiply to get

87.5x=5400

5400/87.5 = x

Answer Link

Otras preguntas

A certain plant grows 1 1/6 inches every week. How ling will it take the plant to grow 6 1/6 inches?

What happened when the Federal Reserve limited the money supply?

Which of these is a resources? A.forests B.all the answers are correct C.oil D.money

F(x)=4-8x find f(-2)

PLEASE I NEED HELP with this question. "In one paragraph, explain what Politically Correct English is"

What is the author's purpose in this excerpt?

Which statement is supported by the declaration of independence A. The government is ruled by the consent of the governed. B. The government cannot force pe

Anyone else a voice actor?

_____is the way a society lives. A.socialization B.ethnocentrism C.culture D.subculture

DNA tacaggtacccgaacccaattta