resedresed43011 resedresed43011
  • 24-12-2020
  • Health
contestada

Metabolism is the rate at which your body converts food into sugar

Respuesta :

covenmarvolodaray
covenmarvolodaray covenmarvolodaray
  • 25-12-2020
Metabolism is the rate which your body coverts food into sugar into simple sugars like glucose etc. our body’s uses fatty acids, amino acids and sugars as energy sources. The blood which uses the compounds to absorb as carry in the blood
Answer Link

Otras preguntas

What is 5/2 divided by 5/7?
How do decisions concerning the allocation and use of resources impact individuals, groups, and relationships?
any crime and violation of _______ has a specific punishment​
Which choice has prokaryotic cells?
A piece of wood with a volume of 489 cm3 and a mass of 153 grams has a density of _______ g/cm3 and will _____ in water.
When did English Parliament pass the Navigation Acts to govern trade between England and the colonies? A) 1776 B) late 1700s C) 1660s D) 1492
Twenty thousand years ago, the Earth was very different than it is today. The world was experiencing an ice age: a period of extreme cold. Parts of the world th
Which impact did the Spanish exploration have on the Native Americans? The Spanish explorers taught Native Americans how to farm. The Spanish explorers brought
will your parents permit you to go abroad? Change to passive voice​
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?